BioSeqAlign

A gem to perform pairwise sequence alignment using the seqan library. Currently, local alignment, global alignment, prefix-suffix alignment (overhang), and fitting alignment (semi-global) are implemented.

If you need to perform pairwise alignment in Ruby, use the align gem (https://github.com/justfalter/align), it's a very nice Ruby implementation. However, if you need a faster alternative, i.e., performing many alignments, bioseqalign can help. Since it uses SeqAn C++ library, it can be much faster than pure Ruby. Alternatively, if you need to perform fitting or prefix-suffix alignment, these are supported without modification.

This gem relies on the following gems/libraries

• [RICE] (https://rubygems.org/gems/rice)
• [SeqAn] (https://www.seqan.de/)

This gem requires SeqAn to be installed on the system, on ubuntu, this can be done by

apt-get install seqan-dev

To install the gem, run

gem install bioseqalign

If you do not have permissions to install SeqAn system-wide, and require a user directory install of seqan-dev, you can specify the path by:

gem install bioseqalign -- --with-seqan-include=/home/username/seqan-1.4.1/

Note, has only been tested with seqan version 1.4+, it can be found here.

Once you install the gem, you can start using it. If you want to perform a fitting alignment, you can try the following.

require 'bioseqalign'

BioSeqAlign.fitAlignStr("AAAAAAAAGCTGAAAAAAAA", "GCTG")

Which would produce the following output

["AAAAAAAAGCTGAAAAAAAA", "--------GCTG--------"]

If you just want the score

BioSeqAlign.fitAlignScore("AAAAAAAAGCTGAAAAAAAA", "GCTG")

Which returns a value of

4