BIGBIO
BigBio = BIG DATA for Ruby
BigBio is an initiative to a create high performance low-memory libraries for big data computing in biology.
BigBio may use BioLib C/C++/D functions for increasing performance and reducing memory consumption.
In a way, this is an experimental project. I use it for experimentation, but what is in here should work fine. If you wish to contribute subscribe to the BioRuby and/or BioLib mailing lists instead.
Overview
- BigBio can translate nucleotide sequences to amino acid sequences using an EMBOSS C function, or BioRuby's translator.
- BigBio has a terrific FASTA file emitter which iterates FASTA files and iterates sequences without loading everything in memory. There is also an indexed edition
- BioBio has a flexible FASTA filter
- BigBio has an ORF emitter which parses DNA/RNA sequences and emits ORFs between START_STOP or STOP_STOP codons.
- BigBio has a Phylip (PAML style) emitter and writer
Installation
The easy way
gem install bio-bigbioin your code
require 'bigbio'Command line tools
Some functionality comes also as executable command line tools (see the ./bin directory). Use the -h switch to get information. Current tools are
- getorf: fetch all areas between start-stop and stop-stop codons in six frames (using EMBOSS when biolib is available)
- nt2aa.rb: translate in six frames (using EMBOSS when biolib is available)
- fasta_filter.rb
Command line Fasta Filter
The CLI filter accepts standard Ruby commands.
Filter sequences that contain more than 25% C's
fasta_filter.rb --filter "rec.seq.count('C') > rec.seq.size*0.25" test/data/fasta/nt.faLook for IDs containing -126 and sequences ending on CCC
fasta_filter.rb --filter "rec.id =~ /-126/ or rec.seq =~ /CCC$/" test/data/fasta/nt.faFilter out all masked sequences that contain more than 10% masked nucleotides
fasta_filter.rb --filter "rec.seq.count('N')<rec.seq.size*0.10" Next to rec.id and rec.seq, you have rec.descr and 'num' as variables, so to skip every other record
fasta_filter.rb --filter "num % 2 == 0" Find all sequences that contain a stop codon in the sequence
fasta_filter.rb --filter 'rec.seq =~ /\*./' aa.faRewrite all sequences to lower case, you can use the useful rewrite option
fasta_filter.rb --rewrite 'rec.seq = rec.seq.downcase'Rewrite the FASTA descriptors
fasta_filter.rb --rewrite 'rec.descr =~ /gene=(\S+)/; rec.descr = $1' test.faFilters and rewrites can be combined. The rest is up to your imagination! One final example to remove low quality sequences from an amino acid file (one amino acid dominates):
fasta_filter.rb --filter "count = {} ; rec.seq.each_char { |c| count[c] ||= 1 ; count[c] += 1 }; count.values.max.to_f/rec.seq.size < 0.30" < aa.fa > aa1.faAPI Examples
Iterate through a FASTA file
Read a file without loading the whole thing in memory
require 'bigbio'
fasta = FastaReader.new(fn)
fasta.each do | rec |
print rec.descr,rec.seq
endSince FastaReader parses the ID, write a tab file with id and sequence
i = 1
print "num\tid\tseq\n"
FastaReader.new(fn).each do | rec |
if rec.id =~ /(AT\w+)/
print i,"\t",$1,"\t",rec.seq,"\n"
i += 1
end
endwich, for example, can be turned into RDF with the bio-table biogem.
Write a FASTA file
Write a FASTA file. The simple way
fasta = FastaWriter.new(fn)
fasta.write('Test',"agtcta")Any object can be passed in, however, as long as it responds to 'descr' and 'seq.to_s', or 'id' and 'seq.to_s'. E.g.
class StorageObject
attr_accessor :descr, :seq
end
mysequence = StorageObject.new
mysequence.descr = 'Test'
mysequence.seq = "agtcta"write the FASTA file
fasta = FastaWriter.new(fn)
fasta.write(mysequence)Transform a FASTA file
You can combine above FastaReader and FastaWriter to transform sequences, e.g.
fasta = FastaWriter.new(in_fn)
FastaReader.new(out_fn).each do | rec |
# Strip the description down to the second ID
(id1,id2) = /(\S+)\s+(\S+)/.match(rec.descr)
fasta.write(id2,rec.seq)
endThe downside to this approach is the explicit file naming. What if you want to use STDIN or some other source instead? I have come round to the idea of using a combination of lambda and block. For example:
FastaReader::emit_fastarecord(-> {gets}) { |rec|
print FastaWriter.to_fasta(rec)
}which takes STDIN line by line, and outputs FASTA on STDOUT. This is a better design as the FastaReader and FastaWriter know nothing of the mechanism fetching and displaying data. These can both be 'pure' functions. Note also that the data is never fully loaded into RAM.
Here the transformer functional style
FastaReader::emit_fastarecord(-> {gets}) { |rec|
(id1,id2) = /(\S+)\s+(\S+)/.match(rec.descr)
print FastaWriter.to_fasta(id2,req.seq)
}Fetch ORFs from a sequence
BigBio can parse a sequence for ORFs. Together with the FastaReader little memory gets used
predictorf = PredictORF.new(id,descr,"ATCATTAGCAACACCAGCTTCCTCTCTCTCGCTTCAAAGTTCACTACTCGTGGATCTCGT")
# get all ORFs between start and stop codons, longer than 30 bps
orfs = predictorf.startstop(30)
# get all sequences between stop codons
seqs = predictorf.stopstop(0)Rapid DNA/RNA to amino acid translation
Translate with EMBOSS C library, if linked, otherwise use BioRuby
trn_table = Bio::Big::TranslationAdapter.translation_table(1)
translate = Nucleotide::Translate.new(trn_table)
aa_frames = translate.aa_6_frames("ATCATTAGCAACACCAGCTTCCTCTCTCTCGCTTCAAAGTTCACTACTCGTGGATCTCGT")Walk a FASTA (reference) genome
Genomes and BACS often come as large (continuous) FASTA files. When variant/position queries happen on sorted data, the genome can be walked through once reading the whole file serially. This is what FastaGenomeReader does.
The following code assumes the FASTA descriptors contain
>13 dna:chromosome chromosome:GRCh37:13:1:115169878:1so 'chr' is captured, as well as 'start' and 'stop'. Using bio-vcf:
genome = FastaGenomeReader.new('Hs_GRCh37_gatk.fasta', ->
{ |descr| a = skip,skip,skip,chr,start,stop = descr.split(':')
chr, start.to_i, stop.to_i } )
STDIN.each_line do | line |
next if line =~ /^#/
fields = VcfLine.parse(line)
rec = VcfRecord.new(fields,header)
if rec.var == genome.ref(vcf.chr,vcf.pos+1)
# do something
end
endFastaGenomeReader is buffered and tiled. You can override the size of 64K.
Project home page
Information on the source tree, documentation, examples, issues and how to contribute, see
http://github.com/pjotrp/bigbio
The BioRuby community is on IRC server: irc.freenode.org, channel: #bioruby.
Cite
If you use this software, please cite one of
- BioRuby: bioinformatics software for the Ruby programming language
- Biogem: an effective tool-based approach for scaling up open source software development in bioinformatics
Biogems.info
This Biogem is published on biogems.info
Copyright
Copyright (c) 2011-2014 Pjotr Prins. See LICENSE for further details.