Website: http://sels.tecnico.pt/orf_finder

ORF-Finder is a library that finds the longest Open Reading Frame (ORF) from a nucleotide sequence.

It will search the sequence for existing start and stop codons and return a single ORF for each frame.

When there is not a ORF present with any of the configurated start and stop codons, then it fallbacks to:

• Using the first codon of the sequence when:
  • No start codon is present;
  • The lenght of an ORF is shorter than the minimum option;
• Using the last codon of the sequence when:
  • No stop codon is present.

note: this was developed in parallell with mass-blast and due to the lack of a Ruby library that had this functionality.

ORF-Finder can be installed from RubyGems.org by:

gem install orf_finder

or adding to the Gemfile:

gem 'orf_finder'

or adding directly from the github repository:

gem 'orf_finder', github: 'averissimo/orf_finder'

There are two classes that can be used to search for ORF,

• ORFinder: can look at both the direct sequence or the complement.

  my_orf = ORFFinder.new('aaaatgaaaaaaatgtaaaaa', min: 3)
  my_orf.nt # returns the longests ORFs for all reading frames as a nucleotide sequence, both the direct and complement
  my_orf.nt # returns the longests ORFs for all reading frames as an amino-acid sequence, both the direct and complement
  

• ORF: only looks at the direct string.

  my_orf = ORF.new('aaaatgaaaaaaatgtaaaaa', min: 3)
  my_orf.nt # returns the longests ORFs for all reading frames as a nucleotide sequence, both the direct and complement
  my_orf.nt # returns the longests ORFs for all reading frames as an amino-acid sequence, both the direct and complement
  

• 'start': list of strings
  • Defines the allowed start codons
• 'stop': list of strings
  • Defines the allowed stop codons
• 'reverse': true/false
  • Whether it should look at the complement
• 'direct': true/false
  • Whether it should look at the direct sequence (as is)
• 'min': integer
  • Minimum length for an ORF to be considered
• 'debug': true/false
  • Whether or not to create an log file

This tool was created as a part of FCT grant SFRH/BD/97415/2013 and European Commission research project BacHBerry (FP7- 613793)

Developer